Detection of Herpes Simplex Virus DNA in Clinical specimens by Polymerasde Chain Reaction (PCR).

Jeon, Sae Jin; Kim, Ki San; Baek, Won Ki; Seo, Sung Il; Seo, Min Ho

Original Article

Journal of the Korean Ophthalmological Society 1996;37(12):1996-2002.
Published online December 1, 1996.

Detection of Herpes Simplex Virus DNA in Clinical specimens by Polymerasde Chain Reaction (PCR).

Sae Jin Jeon, Ki San Kim, Won Ki Baek, Sung Il Seo, Min Ho Seo

¹Department of Ophthalmology, College of Medicine, Keimyung University, Taegu, Korea.
²Department of Microbiology, College of Medicine, Keimyung University, Taegu, Korea.

임상검체에서 PCR을 이용한 헤르페스 바이러스의 검색

전세진(Sae Jin Jeon),김기산(Ki San Kim),백원기(Won Ki Baek),서성일(Sung Il Seo),서민호(Min Ho Seo)

Abstract

The rapid and sensitive diagnostic methods for herpes simplex virus (HSV) infection have been developed. In this study, we employed the polymerase chain reaction (PCR) technique with primer 5 CATCACCGACCCGGAGACGGAC 3 for detection HSV DNA from specimens obtained from the corneal lesion of patients who were suspected of HSV keratitis. The products of PCR was confirmed with agarose gel electrophoresis and southern blot hybridization. Positive results were obtained 4 of 7 typical lesions(2 of 5 dendritic lesions and 2 of 2 geographic lesions) and 7 including 4 without a history of herpetic keratitis of 17 atypical lesions. With these results we could find that PCR technique would be a useful tool for the detection of HSV DNA in both typical and atypical lesion of herpetic keratitis as well as in cases hard to diagnose clinically.

Key Words: Herpes Simplex Virus;Keratitis;Polymerase chain reactiion(PCR)