J Korean Ophthalmol Soc > Volume 62(2); 2021 > Article
Enterococcus faecalis의 퀴놀론 내성 유전자 변이 및 독성인자 유전자 분석

국문초록

목적

안내염을 초래할 수 있는 원인 균주 중 하나인 Enterococcus faecalis의 3가지 퀴놀론 약제에 대한 내성률, 내성 유전자 변이 양상과 독성인자 유전자의 존재를 알아보고자 했다.

대상과 방법

2014년 4월 1일부터 2018년 1월 16일까지 고신대학교 복음병원 안과를 방문하여 유리체절제술, 백내장수술, 안구내주입술을 한 208명의 416안에서 결막상재균을 동정하였다. 각막염, 안내염에서 동정된 E. faecalis도 연구 대상에 포함했다. 결막상재균은 양안 하부 결막낭에서 표본을 채취했고, 각막염, 안내염 환자는 각각 각막과 유리체에서 채취했다. 표본을 배양하여 분리된 E. faecalis를 대상으로 약제 감수성, 유전자 염기서열 변이 및 독성인자 유전자를 확인했다.

결과

결막 채취 표본에서 342균주가 동정되었고 이 중 E. faecalis는 6균주였다. 각막염의 2균주, 안내염에서 8균주를 포함하여 총 16균주로 연구를 진행했다. 16균주 중 6개에서 퀴놀론 약제 내성을 보였다. 유전자 변이는 주로 gyrA, parC에 점 돌연변이가 관찰되었다. 독성인자 유전자 분석 결과 esp, efba, asa1, ace, cylA, gelE를 가지고 있었으며 퀴놀론 내성균과 감수성 균의 차이는 없었다. 젤라틴분해효소 활성 검사 결과 모든 균에서 음성이었다.

결론

E. faecalis에서 37.5%의 퀴놀론 항균제 내성률을 보였다. gyrA, parC 두 유전자 변이가 있는 경우 높은 내성을 보였다. esp, efba, asa1, ace, cylA, gelE 유전자를 독성인자로 가지고 있었다.

ABSTRACT

Purpose

To investigate the resistance rate of Enterococcus faecalis which is one of the causative strains of endophthalmitis to three fluoroquinolone drugs, the quinolone resistance gene mutation patterns, and the presence of virulence factor genes.

Methods

Between April 1, 2014, and January 16, 2018, 416 eyes of 208 patients undergoing cataract surgery, intravitreal injection, or vitrectomy were examined to identify conjunctival commensals. Patients with infective keratitis and infective endophthalmitis were also examined for the presence of E. faecalis. Before the procedure and surgery, samples for identification of conjunctival commensals were collected from the lower conjunctival sac of both eyes. In addition, corneal and vitreous specimens were collected from patients with keratitis and endophthalmitis, respectively. E. faecalis isolated by culturing the samples was tested for drug susceptibility, the presence of gene sequence mutations, and virulence factor genes.

Results

In total, 342 strains were identified in samples from the conjunctiva and included six isolates of E. faecalis. The study was conducted with a total of 16 isolates of E. faecalis, including two from cases of keratitis and eight from cases of endophthalmitis. Six of the 16 strains (37.5%) were resistant to quinolone antibiotics. Point mutations were detected mainly in gyrA and parC. The virulence factors esp, efba, asa1, ace, cylA, and gelE were present in the strains and showed no differences between the quinolone-resistant and quinolone-sensitive strains. Gelatinase activity test was negative for all strains.

Conclusions

The resistance rate of enterococcal clinical isolates identified in the ocular area was 37.5%. The increase in resistance to quinolone antibiotics seems to be related to the presence of mutations in gyrA and parC genes. E. faecalis identified in the eye is thought to possess the virulence factors genes esp, efba, asa1, ace, cylA, and gelE.

Endophthalmitis Vitrectomy Study에 따르면 안내염은 실명을 유발할 수 있는 치명적인 술 후 합병증으로 원인 균주와 시력예후가 매우 밀접한 연관성이 있다고 알려져 있다. 술 후 안내염의 가장 흔한 원인 균주로는 Staphylococcus epidermidis (S. epidermidis)를 포함한 coagulase-negative staphylococci (CNS)인 반면 Enterococcus spp.는 2.2% 동정되었다고 보고하였다[1]. 2004년에 보고된 안내염 연구에서도 가장 흔한 원인 균주는 S. epidermidis이며, Enterococcus spp.는 상대적으로 드물다고 하였다[2]. 그러나, 2013년 스웨덴의 다기관 연구와 2014년 한국의 다기관 연구는 Enterococcus spp.를 가장 흔한 원인균으로 보고하였다[3,4].
안과에서 점안 항균제로 많이 사용되는 퀴놀론은 일차적으로 세균에서 필수 효소로 작용하는 DNA gyrase와 topoisomerase IV를 억제하는 것으로 알려져 있다[5-7]. DNA gyrase는 gyrAgyrB, topoisomerase IV는 parCparE 각각 2개의 소단위를 가지며 대부분의 세균들은 이 4개의 소단위에 특정한 부위에서 변이를 보여 내성을 나타내므로 이 부위를 quinolone-resistance determining region (QRDR)이라 한다[8]. 또한 Enterococci는 콜라겐 결합 세포벽 단백질, 표면 단백질, 피브린 결합 단백질 A, 헤모라이신 그리고 젤라틴 분해효소 등 몇 가지 독성인자를 가질 수 있다[9,10].
퀴놀론 항균제는 점안약의 형태로 안과에서 가장 많이 사용되는 약제이다[11,12]. 퀴놀론 항균제가 안내염 환자로부터 분리된 원인균주 중 E. faecalis에 저조한 제균력을 보이며 이것은 균의 고유내성(intrinsic resistance)과 연관될 것이라고 하였다[13]. E. faecalis의 항균제 내성 연구는 주로 반코마이신 약제와 관련하여 이루어져 왔고 퀴놀론 항균제 내성과 유전자와 관련된 임상연구는 많지 않았다. 2011년 일본에서 비뇨기에서 분리된 E. faecalis 연구에서 QRDR의 gyrA, parC 유전자 돌연변이와 퀴놀론 항균제 내성과의 연관성을 보고하였다[14]. 하지만 비뇨기계 환경은 항균제의 전신흡수 농도에 영향을 받는 반면 안과에서는 점안약의 형태로 사용되므로 약제의 농도가 달라 작용 환경의 차이가 있다[14].
안구표면의 상재균은 배양률이 낮아 국내외 보고가 드물다. 특히 안구에서 배양된 E. faecalis에 대한 감수성 및 이와 관련된 유전자 변이양상에 대해 국내에서 보고된 바가 없다[15-17]. 따라서 본 연구의 목적은 안구영역에서 분리된 E. faecalis의 3가지 퀴놀론 항균제(시프로플록사신, 레보플록사신, 목시플록사신)에 대한 내성과 유전자 변이 양상 그리고 독성인자 유전자 존재를 조사하고자 하였다.

대상과 방법

연구 대상

2014년 4월 1일부터 2018년 1월 16일까지 고신대학교 복음병원 안과를 방문하여 유리체절제술, 백내장수술, 안구내 주입술을 하기 전 결막낭 검체채취에 동의한 208명(416안)에서 동정된 342균주를 대상으로 결막상재균을 조사하였다. 결막상재균에서 동정된 342균주 중 E. faecalis가 16균주였고, 이 중 계대 배양이 가능했던 6균주를 본 연구에 포함하였다. 여기에 감염성 안내염 8안에서 동정된 E. faecalis 8균주와 감염성 각막염 2안에서 동정된 E. faecalis 2균주를 합하여 총 16균주의 E. faecalis를 대상으로 퀴놀론 내성과 유전자 발현 여부를 조사하였다. 결막상재균 조사를 위해서는 양안의 하부 결막낭에서 검체를 채취하였고 감염성 각막염 환자와 감염성 안내염 환자는 각각 각막과 유리체에서 동정된 균을 사용하였다. 수술 및 시술 이전에 본 연구목적과 검체채취에 대한 서면 동의를 환자에게 받았다. 최근 6개월 내에 녹내장 안약, 점안 항균제를 사용하고 있는 경우는 결막 정상균 무리에 영향을 줄 수 있어 결막상재균 조사를 위한 대상에서 제외하였다. 또한 면역결핍질환, 항암제 사용 환자 등 면역 저하 환자, 안구 외 전신적 감염증이 있는 환자, 그리고 전신적 항생제를 투여하고 있는 환자도 연구에서 제외하였다. 본 연구는 고신대학교 복음병원 연구윤리심의위원회의 승인을 받았으며(승인 번호: IRB no. 2017-11-045) 헬싱키선언을 준수하여 진행되었다.

검체 채취 및 보관

결막상재균의 검체 채취를 위해서 술 전 예방적 점안 항균제를 사용하지 않고 점안 마취제와 산동제를 넣기 전 양안 하부 결막낭에서 Polyester tipped swab (23-400-122; Fisher brand™, Pittsburgh, PA, USA)을 이용하여 검체를 채취하였다. 감염성 각막염의 경우 0.5% proparacaine hydrochloride (Alcaine®, Alcon Laboratory, Fort Worth, TX, USA)로 각막을 점안마취한 뒤 No. 15 Bard-Parker knife (Bard-Parker®, Aspen Surgical, Caledonia, MI, USA)로 각막찰과를 통해 검체를 채취하였다. 감염성 안내염환자의 경우 23G trocar를 통해 23G vitreous cutter (Ultravit® probe, Alcon Laboratory, Fort Worth, TX, USA)를 사용하여 검체를 채취하였다. 채취한 검체들은 5% 혈액우무배지에 바로 접종 후 최대 7일간 배양기(Water-Jacketed CO2 Incubator; Thermo Fisher Scientific Forma, Waltham, MA, USA)에서 36.7°C 온도로 배양하였다. 균이 자랄 경우 집락의 모양으로 균종을 분류하여 Eppendorf tube에 보관하였다. 균은 글리세롤과 브루셀라액체배지를 3:7로 섞은 혼합액 1 mL에 균의 집락 1-2개를 풀어서 -70°C 초저온냉동기에 보관하였다.

균의 동정

검체채취를 완료하고 냉동 보관된 검체를 해동하였고 10 µL loop (SPL life sciences, Pocheon, Korea)를 이용하여 다시 5% 혈액우무배지에 접종하였다. 이후 1회 계대배양하여균의 동정 및 항균제 감수성 검사를 실시하였다. 균의 동정은 Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS, Microflex™; Bruker, Billerica, MA, USA)로 시행하였다. MALDI-TOF MS는 세균내 단백질 분자의 질량을 측정하여 패턴을 분석하는 방법으로 짧은 시간 내에 세균 동정이 가능한 방법으로, 기존의 동정법에 비해 신속하고 정확한 세균 동정이 가능한 방법이다.

E. faecalis의 퀴놀론 감수성 검사

항균제 감수성 검사는 액체 배지 미량 희석법(micro-dilution test)을 사용하였으며 안과 영역에서 점안 항균제로 많이 사용되고 있는 3가지 퀴놀론 제제를 대상으로 하였다. 퀴놀론 제제는 주사제로 사용되고 있는 시프로플록사신(Ciprobay®, Bayer, Berlin, Germany), 레보플록사신(Cravit®, Jeilpharm, Daegu, Korea), 목시플록사신(Avelox®, Bayer, Berlin, Germany)을 희석하여 사용하였다. Ciprofloxacin 제제와 레보플록사신 제제의 항균제 감수성 결과는 임상 검사 표준 연구소(Clinical and Laboratory Standards Institute, CLSI) 기준에 따라 의미를 해석하였고 Enterococci의 목시플록사신에 대한 CLSI 기준은 없어, United States Food and Drug Administration (US-FDA)의 기준을 채택하였다(Table 1).
항균제의 최고 농도를 128 μg/mL, 최저 농도를 0.062 μg/mL가 되도록 희석하였고, 균 희석액은 냉동 보관된 균주를 해동하여 대두카제인소화한천배지(tryptic soy agar)에 접종한 후 24시간 배양하여 생성된 세균 집락을 멸균 식염수에 잘 섞어 McFarland standard 0.5가 되도록 조정한 후 사용하였다. 액체배지 80 μL (CAMHB), 희석된 항균제 10 μL, 균주용액 10 μL를 분주한 후 24시간 동안 배양하였다. 이후 3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma-Aldrich, Allentown, PA, USA) solution 5 μL (10 mg/mL)를 첨가하고 2시간 뒤 색이 변하는지 관찰하였으며 색깔의 변화가 일어나지 않은 가장 낮은 농도를 최소 저지농도(minimum inhibitory concentration, MIC)로 정의하였다. 양성 대조군은 배지와 균 희석액을 사용하였고 음성 대조군은 배지만 사용하였다(Fig. 1).

16s rRNA를 이용한 균 확인 및 QRDR의 염기서열 분석

QRDR의 염기서열의 변이를 분석하기 위해 퀴놀론 내성의 존재가 확인된 E. faecalis를 대두카제인소화액체배지(tryptic soy broth, TSB)에 하루 동안 배양하여 원심분리하여 상층액을 제거하고 pelet을 Cetyltrimethylammonium bromide 완충액에 녹여 라이소자임 용액을 첨가하였다. 이후 단백분해효소 K 용액을 첨가하여 반응시킨 뒤 Phenol: Chloroform:Isoamyl alcohol (PCI)을 혼합하고 원심분리하고 상층액을 옮겨 이소프로파놀을 첨가해 DNA를 침전시켰다. 70% 에탄올을 첨가하여 반응시키고 30분 가량 건조를 진행하고 Tris-EDTA (TE) 완충액을 첨가하여 DNA를 녹였다. 0.5 μL를 취하였고 여기에 2 μL PCR primer (forward 1 μL, reverse 1 μL), 10 μL TOP real™ qPCR 2X Premix (Enzynomics, Daejeon, Korea), 8 μL diethyl pyrocarbonate (DEPC) water와 혼합하여 PCR을 시행하였다.
QRDR 염기서열 분석을 위한 PCR primer는 E. faecalis V583의 염기서열을 사용하였으며 E. faecalis임을 확실하게 확인하기 위하여 16s rRNA 염기서열 분석도 함께 시행하였다. 사용한 primer의 염기서열은 Table 2에 제시하였다. PCR은 95˚C, 30 s, 55˚C, 30 s, 72˚C, 30 s 조건으로 30 cycles 시행하였으며 PCR 산물은 1.0% 아가로스 겔 전기영동을 통해 확인하였다(Fig. 2).
PCR 산물은 DNA 정제 및 ABI PRISM 3730XL Analyzer (96 capillary type, Thermo Fisher Scientific, Waltham, MA, USA)를 이용하여 염기서열을 분석하였다. 16 s rRNA의 염기서열은 National Center for Biotechnology Information의 nucleotide Basic Local Alignment Search Tool (BLAST)을 이용하여 확인하였으며 QRDR 부위의 염기서열은 snapgene version 4.2 (GSL Biotech, Chicago, IL, USA)와 genetyx version 6 (GENETYX Corp., Tokyo, Japan)을 사용하여 분석하였다.

PCR을 통한 독성인자 발현 유전자 존재 분석

PCR을 통해 E. faecalis에서 독성인자 esp, efba, hyl, asa1, ace, cylA, gelE를 발현하는 유전자의 존재를 분석하였다. E. faecalis를 TSB에 하루 동안 배양하여 0.5 μL를 취하였고 여기에 2 μL PCR primer (forward 1 μL, reverse 1 μL), 10 μL TOP real™ qPCR 2X Premix (Enzynomics), 8 μL DEPC water와 혼합하여 PCR을 시행하였다. 독성인자의 분석에 사용된 primer의 염기서열과 PCR의 조건은 Table 3에 제시하였다. PCR은 95˚C, 30 s, 55˚C, 30 s, 72˚C, 30 s 조건으로 30주기 시행하였으며 PCR 산물을 1.0% 아가로스 겔 전기영동을 통해 확인하였다(Fig. 2).

젤라틴분해효소 활성 분석

E. faecalis가 젤라틴 분해효소를 생산하는 능력을 검사하기 위해 젤라틴 가수 분해 시험을 시행하였다. 증류수 또는 탈 이온수 1 L에 펩톤 5.0 g, 소고기추출물 3.0 g, 젤라틴 120.0 g을 혼합하고 가열하여 용해시켜 최종 pH 6.8 ± 0.2 at 25°C로 조정한 후 시험관에 3 mL씩 나눠 담고 멸균하였다. 이 배지를 2-8°C에서 냉장하여 응고되도록 하였고 젤라틴 영양 배지 찌르기 방법(nutrient gelatin stab method)으로 18-24시간 된 E. faecalis를 0.5 McFarland (1.5 × 108 CFU/mL) 기준으로 하여 4-5회 접종하였다. 균이 접종된 시험관과 접종되지 않은 시험관을 25°C에서 일주일 동안 배양하며 매일 젤라틴 액화가 발생하였는지 관찰하였다(Fig. 3).

결 과

결막상재균의 분포

결막상재균 조사를 위해 하부결막낭에서 검채를 채취할 수 있었던 416안 중 270안(64.9%)에서 배양이 되어 342균주를 동정하였다. 54안에서는 2균주가, 9안에서는 3균주가 분리되었다. 이 중 그람양성균과 그람음성균의 배양률은 각각 75.15%, 24.85%였다. 이 중 E. faecalis는 16개로 전체 균의 4.68%를 차지하였다(Table 4). 그람양성균에서는 S. epidermidis가 가장 많이 분리되었고(113개, 33.04%) Corynebacterium spp. (62개, 18.13%), S. epidermidis를 제외한 CNS (31개, 9.06%), E. faecalis (16개, 4.68%), S. aureus (15개, 4.39%) 순으로 분리되었다. 그람음성균에서는 Ochrobactrum spp.이 가장 많이 배양되었고(34개, 9.94%), Pseudomonas spp. (11개, 3.22%), Achromobacter spp. 순이었다. E. faecalis 배양 양성안의 환자 분포는 평균 나이 67.43세, 표준편차 12.74였으며 남성 7명, 여성 9명이었다.
결막상재균에서 동정된 16균주 중 계대배양이 가능하였던 6균주, 각막염과 안내염에서 동정된 2균주와 8균주를 합하여 모두 16균주에 대하여 퀴놀론 항생제에 대한 감수성 검사, QRDR 유전자변이 분석, 독성유전자 발현 여부를 조사하였다.

E. faecalis의 퀴놀론제제 감수성 검사 결과

3가지 퀴놀론(시프로플록사신, 레보플록사신, 목시플록사신) 약제에 대한 항균제 감수성 검사를 시행한 결과 E. faecalis 16균주 중 6균주에서 3가지 퀴놀론 약제에 대한 내성이 나타났다(Table 5, Fig. 4).

Nucleotide BLAST를 이용한 16개 E. faecalis의 확인

16s rRNA 염기서열 분석을 통해 16개의 균주 모두 E. faecalis임이 확인되었고, 각 균주는 염기서열 일치율이 높은 순서대로 1번, 2번 strain을 배열하였다(Table 6).

QRDR의 유전자 변이 양상

유전자 변이의 양상과 항균제 MIC값과 비교해 보았다(Table 7). 주로 gyrA, parC에 점 돌연변이(point mutation)가 관찰되었으며, gyrA 84번 세린이 아르지닌 혹은 아이소류신으로, parC 82번 세린이 아이소류신으로 치환된 두 점 돌연변이(two point mutation)의 경우는 MIC값이 높았고 4세대 퀴놀론 항균제인 목시플록사신에 대한 내성도 보였다. 목시플록사신의 MIC에 영향을 끼치는 요인에 대한 다변량분석에서는 parC의 점 돌연변이만이 유의한 것으로 나타났다(Table 8). gyrA 127번 아르지닌이 글라이신으로 치환된 경우에는 항균제 내성을 보이지 않았다. gyrB에 변이를 보인 균주는 발견되지 않았으며 두 균주의 경우 QRDR에 변이가 관찰되지 않았다. parE에도 변이가 관찰되었는데 152번, 162번, 202번 라이신이 아르지닌으로 치환된 경우, 215번 글루탐산이 아스파트산으로 치환된 경우, 그리고 213번 글라이신이 글루탐산으로 치환된 경우로 이 중 점 돌연변이(double point mutation)를 포함한 다양한 형태로 나타났으나 퀴놀론 항균제 내성과의 관련성은 통계적으로 보이지 않았다(Table 8).

E. faecalis의 독성인자 발현 유전자 존재 분석 결과

PCR을 통해 E. faecalis에서 독성인자를 발현하는 유전자의 존재를 분석한 결과를 Table 9에 제시하였다. 16균주 모두 hyl 유전자는 존재하지 않은 반면, asa1, ace, cylA 유전자는 모든 균주에 존재하였다. 특히 세포 파괴 역할을 하는 젤라틴분해효소와 관련된 gelE 유전자는 한 균주를 제외하고 모든 균주에서 존재하였다(93.75%). 또한 E. faecalis는 87.5%에서 esp 유전자를 보유하고 있었다.

젤라틴분해효소 활성 분석 결과

젤라틴 영양 배지 찌르기 방법(nutrient gelatin stab method)을 통한 젤라틴 분해효소 활성 분석 결과 모든 E. faecalis에서 젤라틴 분해효소 활성을 보이지 않았다(negative finding) (Table 10).

고 찰

E. faecalis는 독성인자의 존재로 인해 불량한 시력예후를 야기하는 균으로 알려져 안과의사에게 매우 중요한 세균으로 생각된다[18-20]. 더불어, 안구표면의 상재균으로는 배양률이 매우 낮아 국내외 보고가 드물다. 특히 한국에서는 감수성 및 유전자 변이양상에 대해 보고된 바 없다. 본 연구는 안구에서 동정된 E. faecalis를 이용하여 3가지 퀴놀론 항균제에 대한 감수성, 내성 유전자의 변이 양상을 확인하였고 이와 더불어 독성인자 유전자의 존재를 조사하였다.
세균성 각막염이나 안내염 환자들에게 낮은 세대의 퀴놀론 항균제에 대한 내성 균주의 보고가 증가하고 있다[17,21-23]. 항균제에 대한 내성을 극복하기 위해 새로운 세대의 퀴놀론 항균제 안약이 소개되었고, 이 중 가장 많이 사용되고 있는 안약으로 레보플록사신 0.5%, 목시플록사신 0.5%가 있으며, 임상적으로 점차 사용이 증가되고 있다. 본 연구에서는 시프로플록사신, 레보플록사신, 목시플록사신 3가지 약제를 대상으로 내성 연구를 진행하였다.
동정된 E. faecalis의 37.5% (6/16)에서 시프로플록사신, 레보플록사신, 목시플록사신 3가지 모든 약제에 대해 내성을 보였다. 스웨덴에서 2001년 보고에 의하면, 중환자 집중 치료실에서 분리된 E. faecalis의 29.5%가 시프로플록사신에 대한 내성이 있었다[21]. 일본에서는 42개 기관의 합병 요로감염 환자를 대상으로 하여 분리한 임상균주들 중 E. faecalis가 시프로플록사신과 레보플록사신에 각 18.2%, 17.7%의 내성률을 보였다[22]. 2018년 안구표면에서 분리된 E. faecalis에 대한 노르플록사신, 레보플록사신, 가티플록사신 그리고 목시플록사신에서 모두 26.1%의 내성률을 보였다[17]. 본 연구에서는 37.5%의 내성률을 보여, 현재까지의 다른 보고에 비해 E. faecalis의 퀴놀론 내성이 높아졌다는 것을 확인하였다. 그 원인으로 항균제 사용 증가와의 관련성을 고려해 볼 수 있을 것이다. 2016년 국내 한 병원에서 국민건강보험 자료 분석을 통한 국내 항균제 사용 실태 보고를 하였는데 시프로플록사신, 레보플록사신, 목시플록사신의 전체 처방량이 2002년에는 각각 0.191, 0.133, 0.008 daily defined dose (DDD)/1,000명/day였으나 2013년에는 0.675, 0.978, 0.098 DDD/1,000명/day로 현저히 증가하였고 호흡기, 요로 감염 질환 외 퀴놀론 처방량도 2002년 0.574 DDD/1,000명/day에서 2013년 1.071 DDD/1,000명/day로 증가한 것을 알 수 있다[23].
분리된 16균주에 대한 QRDR 유전자 변이분석 결과에서 gyrB를 제외한 모든 소단위에서 변이가 관찰되었다. gyrA에서 84번, parC에서 82번의 변이를 보인 점은 Sun et al [16]이 발표한 것과 유사하지만 본 연구에서는 parC 유전자 86번과 89번에서 발생한 이중 점 돌연변이(double point mutation)가 앞선 보고와는 다른 아미노산으로 변이가 이루어졌다. 특히 parE 유전자에 대한 변이가 2균주를 제외하고 모두 관찰되었는데 parE 유전자의 152번, 162번, 213번 그리고 215번에서 변이를 보였다.
항균제 내성과 유전자 변이 양상과 연관하여 살펴보면 gyrA, parC 유전자의 변이 개수에 따라 시프로플록사신, 레보플록사신에서 유의하게 높아지는 MIC값을 보였다. 목시플록사신에서는 parC 유전자 변이의 개수에 따라 유의하게 높아지는 MIC값을 보였다. 그러나, parE의 경우 변이의 수가 gyrA, parC만큼 내성에 영향을 주지는 않는 것으로 생각된다. gyrA, parC 두 유전자가 항균제 내성과 연관성을 보였다. 이러한 결과는 안구표면에서 분리된 E. faecalis에 대한 Todokoro et al [17]의 보고와 유사하다. QRDR의 gyrA 유전자에서 아미노산 127번 아르지닌의 변이만 보인 한 균주는 퀴놀론 약제 감수성을 보였다. parE 유전자 변이는 항균제 내성과의 연관성은 없어 보였다. 이와 관련된 다른 연구들을 찾을 수 없었으며 추가적인 연구가 필요하다.
본 연구의 E. faecalis의 퀴놀론 내성에 특이한 패턴을 보이는데, 내성을 보이는 균주에서는 3가지 퀴놀론 약제 모두에서 내성이 있었고, 감수성이 있는 균주에서는 모두 감수성을 보이는 것이다. 이는 Todokoro et al [17]의 보고와 동일한 내성 패턴이다. E. faecalis의 퀴놀론 내성에 관여하는 QRDR의 변이의 유무에 따라 이러한 현상이 발생한다고 추측하고 있다. 이에 관해서는 추가적인 연구가 필요할 것으로 생각된다.
본 연구에서 E. faecalis는 3가지 퀴놀론 약제에 대한 내성이 있는 것으로 나타났다. 그러나, 이 내성 판정은 CLSI에서 제시한 전신 사용할 때를 기준으로 한 것이다. 그러므로 안과에서 퀴놀론 항생제를 점안하게 되면 전신 사용과는 비교할 수 없는 고농도를 사용하는 것이다. 가령, 시중에 판매되는 0.5% 목시플로사신의 한 방울이 0.05 mL라고 한다면, 이 속에는 250 μg의 목시플로사신이 결막에 점안되는 셈이다. 그러므로 본 논문의 결과를 점안항생제에 직접적으로 비교하는 것은 다소 무리가 있다. 그러나, 퀴놀론 항생제에 대한 E. faecalis의 내성이 증가하고 이로 인한 감염증의 위험이 상승하는 것인 사실이기 때문에 안과영역에서도 항생제에 대한 사용에 주의가 필요하다.
한국의 다기관 안내염 연구 보고에 따르면 안내염의 원인균주가 CNS일 때와는 달리 E. faecalis에 의해 발생한 안내염의 경우 증상 발생까지의 기간이 짧으며 그 예후 또한 불량하다고 보고하였다[4,24,25]. 독성인자는 E. faecalis의 조직 파괴와 연관성이 있는데 술 후 안내염이 발생하였을 때 망막을 포함한 그 주변 조직을 파괴하는 데 큰 역할을 할 것으로 생각이 된다. 조사에 포함된 독성인자 유전자는 esp, hyl, efba, asa1, ace, cylA, gelE이고, 각 유전자는 enterococcal surface protein (esp), hyaluronidase (hyl), enterococcal fibronectin-binding protein A (efba), aggregation substance proteins (asa1), collagen-binding protein (ace), cytolysin (cylA), gelatinase (gelE)의 표현형으로 발현된다[9,10,26-30].
독성인자 유전자의 존재 여부를 조사한 결과에서 hyl는 모든 균주에서 관찰되지 않은 반면 efba, asa1, ace, cylA는 모든 균주에서 존재하였다. gelE는 한 균주를 제외한 모든 균에서 존재하였다 (93.75%). Gulhan et al [9]은 53%에서 gelE 독성인자가 존재함을 보고하였고 Iweriebor et al [10]은 ace (97%), gelE (93%) 그리고 esp (68%)의 독성인자 존재를 보고하였다. Iweriebor et al [10]의 연구와는 달리 본 연구와 Armin et al [15]의 연구에서는 모든 E. faecalis 균주에서 efbacylA 유전자를 포함하였다. 본 연구를 포함하여 대부분의 연구에서 acegelE 독성인자의 비율이 높음을 알 수 있다.
하지만 위 임상 균주를 대상으로 실험실에서 이루어진 젤라틴 분해효소의 효소 활성화 분석 결과에서는 모든 균주에서 음성이 나왔다. Zeng et al [31]은 E. faecalis의 젤라틴 분해효소 효소 활성화와 관련된 유전자 분석을 통해 gelE 유전자를 가지고 있더라도 젤라틴 분해효소 활성을 모두 보이는 것은 아니며, gelE 유전자의 발현에 영향을 주는 조절유전자(fsr gene)가 존재한다고 하였다. 본 연구에서 음성 결과를 보인 것은 조절유전자와 연관되었을 가능성이 존재하며 다른 독성인자의 발현에 대한 추가적인 분석도 필요할 것으로 생각된다.
본 연구의 제한점은 유전자 조사에 포함된 E. faecalis의 수가 적으며 단일기관에서 검체를 채취하여 제한적인 표본이라는 점, 내성 결정에 사용된 CLSI 기준이 현실에서 이루어지는 안구 표면의 점안약 농도와 내성에 있어서 차이가 있을 수 있다는 점이다[32]. 따라서 안구에서 분리된 E. faecalis를 지속적으로 수집하여 개체 수를 늘리고 독성인자 유전자의 존재와 그 단백질의 발현과 관련하여 실재 in vivo에서의 영향에 대한 추가 연구가 필요할 것으로 생각된다.
E. faecalis는 안과 영역에서 퀴놀론 항균제 사용 빈도가 증가함에 따라 출현 비율 뿐만 아니라 내성률도 증가하고 있다. E. faecalis에 대한 유전자 분석을 통해 향후 임상에서 항균제를 어떻게 사용하고 개발해야 하는지 중요한 지침 및 근거 자료가 될 수 있을 것이다. 또한 본 연구에서 모든 E. faecalis 균주들에서 세포파괴 독성인자의 유전자가 발현된 것을 감안하였을 때, 안내염의 조기 수술적 치료의 필요성을 더욱 고려해야 하는 근거가 될 수 있어 시사하는 바가 크다.
결론적으로 본 연구는 안구에서 분리된 E. faecalis의 퀴놀론 내성 및 내성 유전자 변이양상 그리고 독성인자 유전자 존재를 밝혔다. 한국 환자에서 분리한 안구 영역의 E. faecalis는 퀴놀론에 대해 상대적으로 높은 내성률을 보였고 gyrA, parC 두 유전자의 변이가 있는 경우 높은 내성을 보였다. 독성인자는 콜라겐 결합 세포벽 단백질을 발현하는 ace 유전자와 젤라틴 분해효소를 각각 발현하는 gelE 유전자가 높은 비율로 존재하였고 젤라틴 분해효소 활성화 분석 결과에서는 모든 균주에서 음성이 나왔다.

NOTES

Conflict of Interest

The authors have no conflicts to disclose.

Figure 1.
Representative picture of micro-dilutional antibiotic sensitivity test for Enterococcus faecalis. Small numbers above each well: concentration of antibiotics (uL/mL). CFX = ciprofloxacin; LFX = levofloxacin; MFX = moxifloxacin; EF = Enterococcus faecalis; R = resistant strain; S = standard strain; PC = positive control (CAMBH 80 μL + bacterial solution 10 μL); NC = negative control (CAMBH 80 μL + antibiotics solution 10 μL).
jkos-2021-62-2-143f1.jpg
Figure 2.
Representative picture of 1.0% agarose gel electrophoresis of polymerase chain reaction (PCR) products. Arabic numbers: sample numbers, S: 16s rRNA, A: gyrA, C: parC.
jkos-2021-62-2-143f2.jpg
Figure 3.
Representative picture of gelatinase activity test of Enterococcus faecalis. The hydrolysis of gelatin indicates the secretion of gelatinase by the test organism into the medium. (A, B) All Enterococcus faecalis included in this study showed negative results. (C) The positive control showed hydrolysis of gelatin.
jkos-2021-62-2-143f3.jpg
Figure 4.
Susceptibility rates of Enterococcus faecalis (n = 16) to fluoroquinolone antibiotics.
jkos-2021-62-2-143f4.jpg
Table 1.
Test was performed in accordance with CLSI performance standards (M100-S25) for dilution antimicrobial susceptibility tests
Antimicrobial agent MIC (μg/mL) Interpretive criteria
Susceptible Intermediate Resistant
Ciprofloxacin ≤1 2 ≥4
Levofloxacin ≤2 4 ≥8
Moxifloxacin* ≤1 2 ≥4

CLSI = Clinical and Laboratory Standards Institute; MIC = minimal inhibitory concentrations.

* No CLSI standard, United States Food and Drug Administration standard was adopted.

Table 2.
The following is the QRDR primer and 16s rRNA primer sequence used in the study. Nucleotide positions are indicated according to GenBank sequence number (Enterococcus faecalis V583) and universial primer of 16s rRNA
Target gene Primer sequence (5’ to 3’) Product size (bp)
gyrA (FOR) ATGAGTGAAGAAATTAAAGAAAACATTCA 384
(REV) ACTCATACGTGCTTCGGTATAACGC
gyrB (FOR) ATGAGAGAACGTGCGCAAGAATATGAC 789
(REV) CGGGGATCCCTTCAATTGAAATGTGTAAGCCTCG
parC (FOR) GTGACAATTTTGGAAAAACGCCAAG 400
(REV) CACCACTTAACTGTGATAAACGAGC
parE (FOR) CGCGGATCCGGCTCACTCTTCTTCTAATTC 685
(REV) CGGGGATCCGGGTTCTTCCCCACGTTCATC
16s rRNA(FOR) CCGTCAATTCMTTTRAGTTT 1534

QRDR = quinolone-resistance determining region.

Table 3.
The following is the virulence factor gene primer sequence used in the study
Target gene Primer sequence (5’ to 3’) Product size (bp)
esp (FOR) CTTTGATTCTTGGTTGTCGGATAC 475
(REV) TTCAACTACCACGGTTTGTTTATC
hyl (FOR) GAGTAGAGGAATATCTTAGC N/A
(REV) AGGCTCCAATTCTGT
efba (FOR) GCACAAGTCCCAAAAGGAGC 510
(REV) AAGTGCGGCTTCAGTAAGGG
asa1 (FOR) TAGGAGTTGTAGGATTAGCTAC 677
(REV) TGTTGTATTCMGCSACTTC
ace (FOR) GGAATGACCGAGAACGATGGC 616
(REV) GCTTGATGTTGGCCTGCTTCCG
cylA (FOR) ACTCGGGGATTGATAGGC 688
(REV) GCTGCTAAAGCTGCGCTT
gelE (FOR) TATGACAATGCTTTTTGGGAT 213
(REV) AGATGCACCCGAAATAATATA
Table 4.
Composition of Gram (+) and Gram (-) microorganisms isolated from ocular clinical specimens
Gram positive bacteria Number of isolates (n = 257) Gram negative bacteria Number of isolates (n = 85)
Staphylococcus epidermidis 113 (33.04) Ochrobactrum spp. 34 (9.94)
Corynebacterium spp. 62 (18.13) Pseudomonas spp. 11 (3.22)
Other CNS 31 (9.06) Achromobacter spp. 8 (2.34)
Enterococcus faecalis 16 (4.68) Brevundimonas spp. 7 (2.05)
Staphylococcus aureus 15 (4.39) Enterobacter aerogenes 4 (1.17)
Micrococcus luteus 6 (1.75) Roseomonas gilardii 4 (1.17)
Propionibacterium avidum 4 (1.17) Bordetella hinzii 3 (0.88)
Kocuria spp. 4 (1.17) Acinetobacter baylyi 2 (0.58)
Lactobacillus spp. 4 (1.17) Delftia acidovorans 2 (0.58)
Bacillus pumilus 2 (0.58) Proteus mirabilis 2 (0.58)
Clostridium bifermentans 1 (0.29) Sphingomonas paucimobilis 3 (0.88)
Dermabacter hominis 1 (0.29) Stenotrophomonas maltophilia 2 (0.58)
Arthrobacter nicotinovorans 1 (0.29) Cupriavidus pauculus 1 (0.29)
Moraxella spp. 1 (0.29)
Morganella morganii 1 (0.29)
Table 5.
Susceptibility results of Enterococcus faecalis (n = 16) to 3 fluoroquinolone antibiotics
Micro-dilution AST, MIC (mg/L)
ID Ciprofloxacin Levofloxacin Moxifloxacin
RA2-1 64 R 64 R 16 R
SD1-2 64 R 64 R 32 R
62od1 64 R 64 R 8 R
16os1 0.5 S 0.5 S 0.25 S
19os2 1 S 1 S 0.25 S
59os1 1 S 1 S 0.5 S
KE2-1 0.5 S 0.5 S 0.25 S
KEFA1 0.5 S 0.5 S 0.25 S
KEFA2 64 R 64 R 8 R
KEFA3 64 R 64 R 16 R
KEFA4 64 R 64 R 32 R
SA7-1 1 S 1 S 0.5 S
SA9-1 1 S 1 S 0.5 S
SA18-2 0.5 S 0.5 S 0.25 S
11 0.5 S 0.5 S 0.25 S
23 0.5 S 0.5 S 0.25 S

AST = antibitotics sensitivity test; MIC = minimum inhibitory concentration; R = resistance; S = sensitive.

Table 6.
Results of 16s rRNA sequencing using BLAST
ID The first matched strain The second matched strain Identify (%)
RA2-1 Enterococcus faecalis V583 Enterococcus faecalis V583 99.77
SD1-2 Enterococcus faecalis strain APUIK-42 Enterococcus faecalis strain CVM N48037F 99.89
62od1 Enterococcus faecalis strain APUIK-42 Enterococcus faecalis strain HA4 100.0
16os1 Enterococcus faecalis strain APUIK-42 Enterococcus faecalis strain HA4 99.89
19os2 Enterococcus faecalis strain TN89 Enterococcus faecalis strain APUIK-42 99.67
59os1 Enterococcus faecalis strain UIP23 Enterococcus faecalis strain LMEM 50 99.21
KE2-1 Enterococcus faecalis strain APUIK-42 Enterococcus faecalis strain PMB56 24 100.0
KEFA1 Enterococcus faecalis strain APUIK-42 Enterococcus faecalis strain DHFe35 99.78
KEFA2 Enterococcus faecalis strain HA 1 Enterococcus faecalis strain TN89 99.66
KEFA3 Enterococcus faecalis strain PMB56 24 Enterococcus faecalis strain APUIK-42 99.66
KEFA4 Enterococcus faecalis strain ALS13 Enterococcus faecalis strain RKD91 58 100.0
SA7-1 Enterococcus faecalis strain APUIK-42 Enterococcus faecalis strain DHFe35 99.88
SA9-1 Enterococcus faecalis strain HA 1 Enterococcus faecalis strain TN89 99.67
SA18-2 Enterococcus faecalis strain PMB56 24 Enterococcus faecalis strain APUIK-42 99.89
11 Enterococcus faecalis strain APUIK-42 Enterococcus faecalis strain DHFe35 100.0
23 Enterococcus faecalis strain HA4 Enterococcus faecalis strain RKD122 48 99.66

BLAST = Basic Local Alignment Search Tool.

Table 7.
Mutations in the QRDR of gyrA, gyrB, parC and parE in 16 strains of Enterococcus faecalis compared the pattern of gene mutations and antibiotic MIC
ID Source QRDR mutation site
MIC (mg/L)
gyrA gyrB parC parE CFX (≥4) LFX (≥8) MFX (≥4)
RA2-1 E Ser84Arg - Ser82Ile Lys162Arg 64 64 16 R
SD1-2 K Ser84Arg - Ser82Ile Lys152Arg 64 64 32 R
62od1 C Ser84Arg - Ser82Ile Lys162Arg+Glu215Asp 64 64 8 R
16os1 C - - - Lys162Arg+Lys202Arg 0.5 0.5 0.25 S
19os2 C - - - Lys202Arg 1 1 0.25 S
59os1 C Arg127Gly - - Lys162Arg 1 1 0.5 S
KE2-1 E - - - Lys152Arg+Gly213Glu 0.5 0.5 0.25 S
KEFA1 E - - - Lys162Arg 0.5 0.5 0.25 S
KEFA2 E Ser84Ile - Ser82Ile - 64 64 8 R
KEFA3 E Ser84Ile - Ser82Ile+Val89Gly Lys152Arg 64 64 16 R
KEFA4 E Ser84Ile - Ser82Ile+Glu86Val - 64 64 32 R
SA7-1 E - - - Lys162Arg 1 1 0.5 S
SA9-1 K - - - Lys162Arg 1 1 0.5 S
SA18-2 E - - - - 0.5 0.5 0.25 S
11 C - - - Lys152Arg+Lys162Arg 0.5 0.5 0.25 S
23 C - - - - 0.5 0.5 0.25 S

QRDR = quinolone resistance determining region; MIC = minimal inhibitory concentration; CFX = ciprofloxacin; LFX = levofloxacin; MFX = moxifloxacin; E = endophthalmitis; K = keratitis; C = commensal; R = resistance; S = sensitive.

Table 8.
Correlation of MICs of quinolones with the number of mutations of QDPR mutation site by multivariate analysis
Number of QDPR mutation site CFX (MIC 0.5-64 mg/L)
LFX (MIC 0.5-64 mg/L)
MFX (MIC 0.25-32 mg/L)
β-coefficient p-value β-coefficient p-value β-coefficient p-value
gyrA (0-1) 25.533 (5.398 to 45.669) 0.017 25.533 (5.398 to 45.669) 0.017 3.194 (-8.488 to 14.877) 0.565
parC (0-2) 25.200 (11.074 to 39.326) 0.002 25.200 (11.074 to 39.326) 0.002 11.000 (2.804 to 19.196) 0.012
pare (0-2) -7.938 (-32.360 to 16.485) 0.497 -7.938 (-32.360 to 16.485) 0.497 -3.969 (-12.406 to 4.468) 0.330

MIC = minimal inhibitory concentration; QRDR = quinolone resistance determining region; CFX = ciprofloxacin; LFX = levofloxacin; MFX = moxifloxacin.

Table 9.
Comparison the pattern of virulence factor gene and antibiotic MIC in 16 strains of Enterococcus faecalis
ID Source Virulence factor gene
MIC (mg/L)
esp efba hyl asa1 ace cylA gelE CFX (≥4) LFX (≥8) MFX (≥4)
RA2-1 E - + - + + + + 64 64 16 R
SD1-2 K + + - + + + + 64 64 32 R
62od1 C + + - + + + + 64 64 8 R
16os1 C + + - + + + + 0.5 0.5 0.25 S
19os2 C + + - + + + + 1 1 0.25 S
59os1 C + + - + + + + 1 1 0.5 S
KE2-1 E + + - + + + + 0.5 0.5 0.25 S
KEFA1 E + + - + + + + 0.5 0.5 0.25 S
KEFA2 E + + - + + + + 64 64 8 R
KEFA3 E + + - + + + + 64 64 16 R
KEFA4 E + + - + + + + 64 64 32 R
SA7-1 E + + - + + + + 1 1 0.5 S
SA9-1 K + + - + + + + 1 1 0.5 S
SA18-2 E + + - + + + + 0.5 0.5 0.25 S
11 C - + - + + + + 0.5 0.5 0.25 S
23 C + + - + + + - 0.5 0.5 0.25 S

MIC = minimal inhibitory concentration; E = endophthalmitis; K = keratitis; C = commensal; CFX = ciprofloxacin; LFX = levofloxacin; MFX = moxifloxacin; R = resistance; S = sensitive.

Table 10.
The results of gelatinase activity in 16 strains of Enterococcus faecalis
ID Source Virulence factor gene
Gelatinase activity
gelE
RA2-1 E + -
SD1-2 K + -
62od1 C + -
16os1 C + -
19os2 C + -
59os1 C + -
KE2-1 E + -
KEFA1 E + -
KEFA2 E + -
KEFA3 E + -
KEFA4 E + -
SA7-1 E + -
SA9-1 K + -
SA18-2 E + -
11 C + -
23 C - -

E = endophthalmitis; K = keratitis; C = commensal.

REFERENCES

1) Durand M. Microbiologic factors and visual outcome in the Endophthalmitis Vitrectomy Study. Am J Ophthalmol 1997;124:127-30.
crossref pmid
2) Benz MS, Scott IU, Flynn HW Jr, et al. Endophthalmitis isolates and antibiotic sensitivities: a 6-year review of culture-proven cases. Am J Ophthalmol 2004;137:38-42.
crossref pmid
3) Friling E, Lundström M, Stenevi U, Montan P. Six-year incidence of endophthalmitis after cataract surgery: Swedish national study. J Cataract Refract Surg 2013;39:15-21.
crossref pmid
4) Kim HW, Kim SY, Chung IY, et al. Emergence of Enterococcus species in the infectious microorganisms cultured from patients with endophthalmitis in South Korea. Infection 2014;42:113-8.
crossref pmid
5) Dubin DT, Fitzgibbon JE, Nahvi MD, John JF. Topoisomerase sequences of coagulase-negative staphylococcal isolates resistant to ciprofloxacin or trovafloxacin. Antimicrob Agents Chemother 1999;43:1631-7.
crossref pmid pmc
6) Li Z, Deguchi T, Yasuda M, et al. Alteration in the GyrA subunit of DNA gyrase and the ParC subunit of DNA topoisomerase IV in quinolone-resistant clinical isolates of Staphylococcus epidermidis. Antimicrob Agents Chemother 1998;42:3293-5.
pmid pmc
7) Sreedharan S, Peterson LR, Fisher LM. Ciprofloxacin resistance in coagulase-positive and -negative staphylococci: role of mutations at serine 84 in the DNA gyrase a protein of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob Agents Chemother 1991;35:2151-4.
crossref pmid pmc
8) Yamada M, Yoshida J, Hatou S, et al. Mutations in the quinolone resistance determining region in Staphylococcus epidermidis recovered from conjunctiva and their association with susceptibility to various fluoroquinolones. Br J Ophthalmol 2008;92:848-51.
crossref pmid pmc
9) Gulhan T, Boynukara B, Ciftci A, et al. Characterization of Enterococcus faecalis isolates originating from different sources for their virulence factors and genes, antibiotic resistance patterns, genotypes and biofilm production. Iran J Vet Res 2015;16:261-6.
pmid pmc
10) Iweriebor BC, Obi LC, Okoh AI. Virulence and antimicrobial resistance factors of Enterococcus spp. isolated from fecal samples from piggery farms in Eastern Cape, South Africa. BMC Microbiol 2015;15:136.
pmid pmc
11) Seal DV, Barry P, Gettinby G, et al. ESCRS study of prophylaxis of postoperative endophthalmitis after cataract surgery: case for a European multicenter study. J Cataract Refract Surg 2006;32:396-406.
crossref pmid
12) Barry P, Seal DV, Gettinby G, et al. ESCRS study of prophylaxis of postoperative endophthalmitis after cataract surgery: preliminary report of principal results from a European multicenter study. J Cataract Refract Surg 2006;32:407-10.
pmid
13) Dave VP, Pathengay A, Braimah IZ, et al. Enterococcus endophthalmitis: clinical settings, antimicrobial susceptibility, and management outcomes. Retina 2020;40:898-902.
pmid
14) Yasufuku T, Shigemura K, Shirakawa T, et al. Mechanisms of and risk factors for fluoroquinolone resistance in clinical Enterococcus faecalis isolates from patients with urinary tract infections. J Clin Microbiol 2011;49:3912-6.
crossref pmid pmc
15) Armin S, Fallah F, Karimi A, et al. Genotyping, antimicrobial resistance and virulence factor gene profiles of vancomycin resistance Enterococcus faecalis isolated from blood culture. Microb Pathog 2017;109:300-4.
crossref pmid
16) Sun Y, Lu H, Zhang X, et al. Phenotype and genotype alteration during adaptive evolution of Enterococcus faecalis to antimicrobials. Infect Genet Evol 2018;62:80-5.
crossref pmid
17) Todokoro D, Eguchi H, Suzuki T, et al. Genetic diversity and persistent colonization of Enterococcus faecalis on ocular surfaces. Jpn J Ophthalmol 2018;62:699-705.
crossref pmid
18) Kuriyan AE, Sridhar J, Flynn HW Jr, et al. Endophthalmitis caused by Enterococcus faecalis: clinical features, antibiotic sensitivities, and outcomes. Am J Ophthalmol 2014;158:1018-23.
crossref pmid pmc
19) Todokoro D, Suzuki T, Kobayakawa S, et al. Postoperative Enterococcus faecalis endophthalmitis: virulence factors leading to poor visual outcome. Jpn J Ophthalmol 2017;61:408-14.
crossref pmid
20) Sadaka A, Durand ML, Gilmore MS. Bacterial endophthalmitis in the age of outpatient intravitreal therapies and cataract surgeries: host-microbe interactions in intraocular infection. Prog Retin Eye Res 2012;31:316-31.
crossref
21) Hällgren A, Abednazari H, Ekdahl C, et al. Antimicrobial susceptibility patterns of Enterococci in intensive care units in Sweden evaluated by different MIC breakpoint systems. J Antimicrob Chemother 2001;48:53-62.
crossref pmid
22) Ishikawa K, Hamasuna R, Uehara S, et al. Japanese nationwide surveillance in 2011 of antibacterial susceptibility patterns of clinical isolates from complicated urinary tract infection cases. J Infect Chemother 2015;21:623-33.
23) NHIS. A study on the use of antibacterial agents in Korea and the resistance of major pathogens to antibacterial agents. Goyang: NHIS (KR); 2016. p. 116.Report No.: 2016-20-001.
24) Nam KY, Lee JE, Lee JE, et al. Clinical features of infectious endophthalmitis in South Korea: a five-year multicenter study. BMC Infect Dis 2015;15:177.
crossref pmid pmc
25) Nam KY, Kim HW, Jeung WJ, et al. Comparison of the most common isolates of postoperative endophthalmitis in South Korea; Enterococcus species vs coagulase-negative Staphylococci. BMC Infect Dis 2016;16:706.
crossref pmid pmc
26) Coburn PS, Gilmore MS. The Enterococcus faecalis cytolysin: a novel toxin active against eukaryotic and prokaryotic cells. Cell Microbiol 2003;5:661-9.
crossref
27) Kristich CJ, Li YH, Cvitkovitch DG, Dunny GM. Esp-independent biofilm formation by Enterococcus faecalis. J Bacteriol 2004;186:154-63.
crossref pmid pmc
28) Shankar V, Baghdayan AS, Huycke MM, et al. Infection-derived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infect Immun 1999;67:193-200.
crossref pmid pmc
29) Barbosa-Ribeiro M, De-Jesus-Soares A, Zaia AA, et al. Antimicrobial susceptibility and characterization of virulence genes of enterococcus faecalis isolates from teeth with failure of the endodontic treatment. J Endod 2016;42:1022-8.
crossref pmid
30) Torelli R, Serror P, Bugli F, et al. The PavA-like fibronectin-binding protein of Enterococcus faecalis, EfbA, is important for virulence in a mouse model of ascending urinary tract infection. J Infect Dis 2012;206:952-60.
crossref pmid
31) Zeng J, Teng F, Murray BE. Gelatinase is important for translocation of Enterococcus faecalis across polarized human enterocyte-like T84 cells. Infect Immun 2005;73:1606-12.
crossref pmid pmc
32) Kowalski RP, Yates KA, Romanowski EG, et al. An ophthalmologist’s guide to understanding antibiotic susceptibility and minimum inhibitory concentration data. Ophthalmology 2005;112:1987.
crossref pmid

Biography

이승하 / Seung Ha Lee
고신대학교 의과대학 안과학교실
Department of Ophthalmology, Kosin University College of Medicine
jkos-2021-62-2-143i1.jpg
TOOLS
METRICS Graph View
  • 0 Crossref
  •  0 Scopus
  • 166 View
  • 23 Download
Related articles


ABOUT
BROWSE ARTICLES
EDITORIAL POLICY
FOR CONTRIBUTORS
Editorial Office
SKY 1004 Building #701
50-1 Jungnim-ro, Jung-gu, Seoul 04508, Korea
Tel: +82-2-583-6520    Fax: +82-2-583-6521    E-mail: kos08@ophthalmology.org                

Copyright © 2021 by Korean Ophthalmological Society. All rights reserved.

Developed in M2PI

Close layer
prev next